It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. The Turkish G-M377 is somewhat closer, but not identical. Its chromosome location listed as 21653414. Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ : Y-chromosome diversity characterizes the Gulf of Oman. Hum Genet 2004; 114: 127148. Such temporal estimates must be viewed with caution owing to differences in individual STR locus mutation rates, sensitivity to rare outlier STR alleles and complexities related to multiple potential founders during a demographic event. [citation needed] The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world even though the average rate at the national level is about 1% or less. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. Haplogroup P (P295) is also klnown as K2b2. Haplogroup G1 is a primary subclade of haplogroup G . M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. Dulik MC, Osipova LP, Schurr TG : Y-chromosome variation in Altaian Kazakhs reveals a common paternal gene pool for Kazakhs and the influence of Mongolian expansions. L2b1a. L141 persons who do not belong to any L141 subclade so far have the value of 11 at STR marker DYS490 a finding rare in other G categories. To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. Another notable feature is its uneven distribution. The International Society of Genetic Genealogy (ISOGG) maintains the most up-to-date consensus version of haplogroup categories. Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. The mutation is found on the Y chromosome at 10595022 and is a change from G to C. G-L30 (also G-PF3267, G-S126 or G-U8; G2a2b, previously G2a3) Am J Hum Genet 2008; 82: 236250. The L141 mutation involves an insertion.[35]. The phylogenetic relationships of the various sub-haplogroups investigated are shown in Figure 1. G is found mostly in the north central Middle East and the Caucasus, with smaller numbers around the Mediterranean and eastward. Balanovsky O, Dibirova K, Dybo A et al. . Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. The Morans I coefficient was calculated using the PASSAGE software v.1.1 (Phoenix, AZ, USA) with binary weight matrix, nine distance classes and random distribution assumption. The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. Summary. Achilli A, Olivieri A, Pala M et al. Cavalli-Sforza L, Menozzi P, Piazza A : The History and Geography of Human Genes. (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. Proc Natl Acad Sci USA 2011; 108: 1825518259. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. The genome-wide structure of the Jewish people. Gurdeep Matharu Lall, Maarten H. D. Larmuseau, Mark A. Jobling, Hovhannes Sahakyan, Ashot Margaryan, Richard Villems, Javier Rodriguez Luis, Leire Palencia-Madrid, Rene J. Herrera, Sandra Oliveira, Alexander Hbner, Jorge Rocha, Alessandra Modi, Desislava Nesheva, David Caramelli, Maxat Zhabagin, Zhaxylyk Sabitov, Elena Balanovska, Veronika Csky, Dniel Gerber, Anna Szcsnyi-Nagy, European Journal of Human Genetics BMC Evol Biol 2011; 11: 69. The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK. Am J Hum Genet 2012; 90: 573. Evaluation of Y-chromosomal STRs: a multicenter study. The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. Almost all L141 men belong to L141 subclades. Whereas the presence of Mideastern mtDNA in Tuscany43 supports the model of early Iron Age migrants from Anatolia (putative Etruscans) colonizing Central Italy,44 the occurrence of the G2a3b1c-L497 lineage in Italy is most likely associated to migratory flows from the north. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%. G-M377, now also known as G2b1, has previously been designated G2b and G2c. ASD0 is the average squared difference in the number of repeats between all current chromosomes of a sample and the founder haplotype, which is estimated as the median of current haplotypes. The hg G-U1 subclade is characterized by several sub-clusters of haplotypes, including a more diverse cluster mostly represented by Caucasus populations. Flores C, Maca-Meyer N, Gonzalez AM et al. Evolutionary Biology Group, Estonian Biocentre, Tartu, Estonia, Siiri Rootsi,Mari Jrve,Ildus Kutuev,Krt Varendi,Hovhannes Sahakyan,Doron M Behar,Alena Kushniarevich&Richard Villems, Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, Stanford, CA, USA, Department of Evolutionary Biology, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia, Institute of Biochemistry and Genetics, Ufa Research Center, Russian Academy of Sciences, Ufa, Russia, Ildus Kutuev,Elza K Khusnutdinova&Rita Khusainova, Departamento de Gentica, Facultad de Biologa, Universidad de La Laguna, Tenerife, Spain, Human Genetics Group, Institute of Molecular Biology, Academy of Sciences of Armenia, Yerevan, Armenia, Hovhannes Sahakyan,Levon Yepiskoposyan&Ardeshir Bahmanimehr, Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow, Russia, Institute for Anthropological Research, Zagreb, Croatia, Immunology department, Allergy Research Center, Shiraz University of Medical Sciences, Shiraz, Iran, Department of Human and Molecular Genetics, College of Medicine, Florida International University, Miami, FL, USA, Dipartimento di Biologia e Biotecnologie L. In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. The expansion time of G-M406 in Anatolia is 12800 years ago, which corresponds to climatic improvement at the beginning of the Holocene and the commencement of sedentary hunter-forager settlements at locations, such as Gobekli Tepi in Southeast Anatolia, thought to be critical for the domestication of crops (wheat and barley) that propelled the development of the Neolithic. Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. The G-M286 subclade (M286+) is small compared with G-L91. [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. The authors declare no conflict of interest. Men who belong to this group but are negative for all its subclades represent a small number today. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. The general frequency pattern of hg G overall (Figure 2a) shows that the spread of hg G extends over an area from southern Europe to the Near/Middle East and the Caucasus, but then decreases rapidly toward southern and Central Asia. The Sea Peoples, from cuneiform tablets to carbon dating. The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. The corresponding coalescent estimate for M377 is 5600 years ago (Supplementary Table S4). PubMedGoogle Scholar. Hum Hered 2006; 61: 132143. Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. Google Scholar. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Am J Hum Genet 2004; 74: 788788. Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[14] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. On this Wikipedia the language links are at the top of the page across from the article title. Int J Legal Med 1997; 110: 134149. Although M527 frequency (Supplementary Table S1) is relatively low (16%), its phylogeographic distribution in regions such as southern Italy, Ukraine and the Levant (Druze and Palestinians) often coincides with areas associated with the Neolithic and post-Neolithic expansions into the Greek Aegean beginning approximately 7000 years ago.41 The expansion time (Td) of M527 is 71002300 years ago and is consistent with a Middle to Late Neolithic expansion of M527 in the Aegean. The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. Taken as a collective group, P303-derived chromosomes are the most widespread of all hg G lineages (Supplementary Table S1 and Figure 2b) and clearly display differential geographic partitioning between L497 (Figure 2c) and U1 (xM527) (Figure 2d). To obtain Origin. In contrast to its widely dispersed sister clade defined by P303, hg G-M406 has a peak frequency in Cappadocia, Mediterranean Anatolia and Central Anatolia (67%) and it is not detected in most other regions with considerable P303 frequency. However, interpretations based on simple haplogroup frequency clines do not recognize underlying patterns of genetic diversification. Here we address this issue with a phylogeographic overview of the distribution of informative G sub-clades from South/Mediterranean Europe, Near/Middle East, the Caucasus and Central/South Asia. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. The origin of haplogroup G is controversial. In contrast to G1, the absolute majority of hg G samples belonged to G2-P287-related sub-clades, with the vast majority of them being associated with G2a-P15-related lineages. Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G. In South Asia, some ethnic minorities possess haplogroup G at concentrations of approximately 18%[21] to 20%[22] of Kalash, approximately 16% of Brahui,[22] and approximately 11.5% of sampled Pashtun,[21] but in only about 3% of the general Pakistani population. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. [42] The technical specifications of M201 are given as: refSNPid is rs2032636..Y chromosome location of 13536923.forward primer is tatgcatttgttgagtatatgtc..reverse primer is gttctgaatgaaagttcaaacg..the mutation involves a change from G to T. A number of SNPs have been identified with seemingly the same coverage in the population as M201. The network was obtained using the biallelic markers P303, M426, L497, U1, M527 and 19 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461 (TAGA counts), DYS385a,b, DYS437, DYS438, DYS448, DYS456, DYS458, DYS635, YGATAH4). Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter. The frequency data were converted into isofrequency maps using the Surfer software (version 8, Golden Software, Inc., Golden, CO, USA), following the kriging algorithm using advanced options to use bodies of waters as breaklines. A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. Important caveats to consider include the fact that Td is sensitive to authentic rare outlier alleles and that multiple founders during population formation will inflate the age estimate of the event. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*, The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs. Gene pool structure of Eastern Ukrainians as inferred from the Y-chromosome haplogroups. Semino O, Passarino G, Oefner PJ et al. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). . [25], In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. https://doi.org/10.1038/ejhg.2012.86, DOI: https://doi.org/10.1038/ejhg.2012.86. In Lebanon, however, G accounts for 6.5% of the population and in Iran to around 10%. Provided by the Springer Nature SharedIt content-sharing initiative, European Journal of Human Genetics (2021), European Journal of Human Genetics (2020), European Journal of Human Genetics (Eur J Hum Genet) We performed principal component analysis to determine the affinities of various hg G fractions with respect to total M201 among different populations, using the frequency distributions of the following sub-clades: M285, P20, M377, M287, P287, P15*, P16, M286, M485, P303*, L497, U1*, M527, M406 and Page19. Spatial frequency maps for sub-clades (panels bf) were obtained by applying the frequencies from Supplementary Table S1 using the Surfer software (version 8, Golden Software, Inc.), following the kriging algorithm with option to use bodies of water as breaklines. This video explains the migration route of Y-chromosome haplogroup G and the countries where it can be found today. Thus, these estimates should be viewed as the upper bounds of dispersal times. The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. Another frequent sub-clade of the G2a3-M485 lineage is G2a3a-M406 (Figure 2e). We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaians. These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. Haplogroup G was the first branch of Haplogroup F outside of Africa. [20] The city is on the banks of the river Drava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. Hum Genet 2009; 126: 707717. The discovery of new SNPs can result in assignment of new names to haplogroup categories. In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males. Am J Hum Genet 2004; 74: 694704. We genotyped binary markers following PCR amplification, by either Denaturing High Performance Liquid Chromatography, RFLP analysis, Taqman assay (Applied Biosystems, Foster City, CA, USA) or direct Sanger sequencing methodology. The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Haplogroup L2b1a is a branch on the maternal tree of human kind. Semino et al. (2004) suggested the mutation took place only 9,500 years ago. Croat Med J 2005; 46: 502513. Moreover, the accuracy and validity of the evolutionary rate has been independently confirmed in several deep-rooted Hutterite pedigrees.34 Furthermore pedigree rate-based estimates cannot be substantiated, as they are often inconsistent with dateable archeological knowledge, for example, as clearly illustrated regarding the peopling of the Americas.35 Coalescent times based on 10 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461-TAGA counts) and the median haplotypes of specific hg G sub-haplogroups are presented in Supplementary Table S4. They are found only in tiny numbers elsewhere. Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. The haplogroups contain many branches called subhaplogroups or subclades. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68].
The Boathouse Disney Springs Thanksgiving Menu,
Field Club Membership Fees,
Judy Martin Hess Illness,
Sunset Funeral Home Northport, Al Obituaries,
Vintage Jet Boat Forums,
Articles H